circad | circRNAs associated with diseases

hsa_circRNA_102034
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Rheumatoid Arthritis	ICD-10	Rheumatoid arthritis, unspecified (M06.9)
DBLink	Link to database	PMID	https://academicjournals.org/journal/AJB/article-full-text-pdf/9E8BCC658074
Experimental Method
Sample Type	Peripheral blood lymphocytes	Comparison	Three RA patients (1 man and 2 women; age range of 50 to 62 years). As controls, three healthy volunteers were recruited (1 man and 2 women; age range of 49 to 63 years).
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTCATCTGTATAGTGTATGCCGTTA Reverse CAGCTGGAATGGTGATTTCTT	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
https://academicjournals.org/journal/AJB/article-full-text-pdf/9E8BCC658074